Circadian Gene Variants: Effects in Overweight and Obese Pregnant Women.

Obesity and overweight are common and complex conditions influenced by multiple genetic and environmental factors. Several genetic variants located in the genes involved in clock systems and fat taste perception can affect metabolic health. In particular, the polymorphisms in CLOCK and BMAL1 genes were reported to be significantly related to cardiovascular disease, metabolic syndrome, sleep reduction, and evening preference. Moreover, genetic variants in the CD36 gene have been shown to be involved in lipid metabolism, regulation of fat intake, and body weight regulation. The aim of this study is to evaluate, for the first time, the association between variants in some candidate genes (namely, BMAL1 rs7950226 (G>A), CLOCK rs1801260 (A>G), CLOCK rs4864548 (G>A), CLOCK rs3736544 (G>A), CD36 rs1984112 (A>G), CD36 rs1761667 (G>A)) and overweight/obesity (OB) in pregnant women. A total of 163 normal-weight (NW) and 128 OB participants were included. A significant correlation was observed between A-allele in CLOCK rs4864548 and an increased risk of obesity (OR: 1.97; 95% CI 1.22-3.10, p = 0.005). In addition, we found that subjects carrying the haplotype of rs1801260-A, rs4864548-A, and rs3736544-G are likely to be overweight or obese (OR 1.47, 95% CI 1.03-2.09, p = 0.030), compared with those with other haplotypes. Moreover, a significant relation was observed between third-trimester lipid parameters and genetic variants-namely, CD36 rs1984112, CD36 rs1761667, BMAL1 rs7950226, and CLOCK rs1801260. A multivariate logistic regression model revealed that CLOCK rs4864548 A-allele carriage was a strong risk factor for obesity (OR 2.05, 95% CI 1.07-3.93, p = 0.029); on the other hand, greater adherence to Mediterranean diet (OR 0.80, 95% CI 0.65-0.98, p = 0.038) and higher HDL levels (OR 0.96, 95% CI 0.94-0.99, p = 0.021) were related to a reduced risk of obesity. Interestingly, an association between maternal CLOCK rs4864548 and neonatal birthweight was detected (p = 0.025). These data suggest a potential role of the polymorphisms in clock systems and in fat taste perception in both susceptibility to overweight/obesity and influencing the related metabolic traits in pregnant women.

The polymorphism analysis for CD36 among platelet donors.

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.

A novel fatty acid analogue triggers CD36-GPR120 interaction and exerts anti-inflammatory action in endotoxemia.

Inflammation is a mediator of a number of chronic pathologies. We synthesized the diethyl (9Z,12Z)-octadeca-9,12-dien-1-ylphosphonate, called NKS3, which decreased lipopolysaccharide (LPS)-induced mRNA upregulation of proinflammatory cytokines (IL-1ß, IL-6 and TNF-α) not only in primary intraperitoneal and lung alveolar macrophages, but also in freshly isolated mice lung slices. The in-silico studies suggested that NKS3, being CD36 agonist, will bind to GPR120. Co-immunoprecipitation and proximity ligation assays demonstrated that NKS3 induced protein-protein interaction of CD36 with GPR120in RAW 264.7 macrophage cell line. Furthermore, NKS3, via GPR120, decreased LPS-induced activation of TAB1/TAK1/JNK pathway and the LPS-induced mRNA expression of inflammatory markers in RAW 264.7 cells. In the acute lung injury model, NKS3 decreased lung fibrosis and inflammatory cytokines (IL-1ß, IL-6 and TNF-α) and nitric oxide (NO) production in broncho-alveolar lavage fluid. NKS3 exerted a protective effect on LPS-induced remodeling of kidney and liver, and reduced circulating IL-1ß, IL-6 and TNF-α concentrations. In a septic shock model, NKS3 gavage decreased significantly the LPS-induced mortality in mice. In the last, NKS3 decreased neuroinflammation in diet-induced obese mice. Altogether, these results suggest that NKS3 is a novel anti-inflammatory agent that could be used, in the future, for the treatment of inflammation-associated pathologies.

Nobiletin alleviates atherosclerosis by inhibiting lipid uptake via the PPARG/CD36 pathway.

BACKGROUND: Atherosclerosis (AS) is a persistent inflammatory condition triggered and exacerbated by several factors including lipid accumulation, endothelial dysfunction and macrophages infiltration. Nobiletin (NOB) has been reported to alleviate atherosclerosis; however, the underlying mechanism remains incompletely understood. METHODS: This study involved comprehensive bioinformatic analysis, including multidatabase target prediction; GO and KEGG enrichment analyses for function and pathway exploration; DeepSite and AutoDock for drug binding site prediction; and CIBERSORT for immune cell involvement. In addition, target intervention was verified via cell scratch assays, oil red O staining, ELISA, flow cytometry, qRT‒PCR and Western blotting. In addition, by establishing a mouse model of AS, it was demonstrated that NOB attenuated lipid accumulation and the extent of atherosclerotic lesions. RESULTS: (1) Altogether, 141 potentially targetable genes were identified through which NOB could intervene in atherosclerosis. (2) Lipid and atherosclerosis, fluid shear stress and atherosclerosis may be the dominant pathways and potential mechanisms. (3) ALB, AKT1, CASP3 and 7 other genes were identified as the top 10 target genes. (4) Six genes, including PPARG, MMP9, SRC and 3 other genes, were related to the M0 fraction. (5) CD36 and PPARG were upregulated in atherosclerosis samples compared to the normal control. (6) By inhibiting lipid uptake in RAW264.7 cells, NOB prevents the formation of foam cell. (7) In RAW264.7 cells, the inhibitory effect of oxidized low-density lipoprotein on foam cells formation and lipid accumulation was closely associated with the PPARG signaling pathway. (8) In vivo validation showed that NOB significantly attenuated intra-arterial lipid accumulation and macrophage infiltration and reduced CD36 expression. CONCLUSIONS: Nobiletin alleviates atherosclerosis by inhibiting lipid uptake via the PPARG/CD36 pathway.

Systemic loss of CD36 aggravates NAFLD-related HCC through MEK1/2-ERK1/2 signaling pathway.

BACKGROUND & AIMS: CD36, a membrane protein widely present in various tissues, is crucial role in regulating energy metabolism. The rise of HCC as a notable outcome of NAFLD is becoming more apparent. Patients with hereditary CD36 deficiency are at increased risk of NAFLD. However, the impact of CD36 deficiency on NAFLD-HCC remains unclear. METHODS: Global CD36 knockout mice (CD36KO) and wild type mice (WT) were induced to establish NAFLD-HCC model by N-nitrosodiethylamine (DEN) plus high fat diet (HFD). Transcriptomics was employed to examine genes that were expressed differentially. RESULTS: Compared to WT mice, CD36KO mice showed more severe HFD-induced liver issues and increased tumor malignancy. The MEK1/2-ERK1/2 pathway activation was detected in the liver tissues of CD36KO mice using RNA sequencing and Western blot analysis. CONCLUSION: Systemic loss of CD36 leaded to the advancement of NAFLD to HCC by causing lipid disorders and metabolic inflammation, a process that involves the activation of MAPK signaling pathway. We found that CD36 contributes significantly to the maintenance of metabolic homeostasis in NAFLD-HCC.

Effects of Lizhong Tongmai acupuncture on TMAO, CD36 expression, and cholesterol deposition in atherosclerotic mice. / "理中通脉"æ³•é’ˆåˆºå¯¹åŠ¨è„‰ç²¥æ ·ç¡¬åŒ–å°é¼ TMAO、CD36表达及胆固醇沉积的影响.

OBJECTIVES: To observe the effects of Lizhong Tongmai acupuncture (acupuncture for regulating middle jiao and promoting meridians) on trimethylamine-N-oxide (TMAO), CD36 expression, and cholesterol deposition in atherosclerotic (AS) mice, exploring potential mechanism of electroacupuncture (EA) in treating AS. METHODS: A total of 31 male SPF-grade C57BL/6J ApoE-/- mice were fed with high-fat diet for 8 weeks to establish AS model. After successful modeling, the remaining 30 mice were randomly divided into a model group, a medication group, and an EA group, with 10 mice in each group. An additional 10 normal mice of the same strain were selected as a blank group. The mice in the blank group and the model group received no intervention. The mice in the medication group were treated with intragastric administration of atorvastatin calcium. The mice in the EA group were treated with EA at "Neiguan" (PC 6), "Tianshu" (ST 25) and "Zusanli" (ST 36). The same-side "Neiguan" (PC 6) and "Zusanli" (ST 36), "Tianshu" (ST 25) and the tail of the mice were connected to the EA apparatus, with disperse-dense wave, a frequency of 2 Hz/15 Hz, and a current intensity of 0.3 mA for 10 min per session. Acupuncture was performed unilaterally per session, alternating between the left and right sides, with a frequency of once every other day. After intervention, HE staining was used to observe the pathological morphology of the aorta. Microplate assays were conducted to measure triglyceride (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) levels in serum. Ultra high performance liquid chromatography-mass spectrometry technique (UPLC-MS) was employed to detect TMAO level in plasma. Western blot was performed to assess CD36 protein expression level in the aorta. Microanalysis was used to measure cholesterol ester (CE) level in the aorta and the CE/TC ratio was calculated. RESULTS: Compared with the blank group, the mice in the model group exhibited significant pathological changes of atherosclerosis, serum TG, TC, LDL-C levels were increased (P<0.01), and HDL-C level was decreased (P<0.01); the plasma TMAO level, aortic CE level, and the CE/TC ratio were increased (P<0.01), along with elevated CD36 protein expression level in the aorta (P<0.01). Compared with the model group, the mice in the medication group and the EA group showed improvements in aortic pathology, serum TG, TC, LDL-C levels were reduced, HDL-C levels were increased (P<0.05); plasma TMAO levels, aortic CE levels, and the CE/TC ratio were decreased (P<0.01), and CD36 protein expression levels were lowered (P<0.05). The serum TG and TC levels in the EA group were higher than those in the medication group (P<0.05). CONCLUSIONS: The Lizhong Tongmai acupuncture can ameliorate aortic pathological changes, regulate blood lipid levels, reduce plasma TMAO level, inhibit CD36 protein expression in the aorta, and decrease cholesterol deposition. These effects may contribute to the therapeutic mechanism of EA in treating AS.

Glycolysis-Mediated Activation of v-ATPase by Nicotinamide Mononucleotide Ameliorates Lipid-Induced Cardiomyopathy by Repressing the CD36-TLR4 Axis.

BACKGROUND: Chronic overconsumption of lipids followed by their excessive accumulation in the heart leads to cardiomyopathy. The cause of lipid-induced cardiomyopathy involves a pivotal role for the proton-pump vacuolar-type H+-ATPase (v-ATPase), which acidifies endosomes, and for lipid-transporter CD36, which is stored in acidified endosomes. During lipid overexposure, an increased influx of lipids into cardiomyocytes is sensed by v-ATPase, which then disassembles, causing endosomal de-acidification and expulsion of stored CD36 from the endosomes toward the sarcolemma. Once at the sarcolemma, CD36 not only increases lipid uptake but also interacts with inflammatory receptor TLR4 (Toll-like receptor 4), together resulting in lipid-induced insulin resistance, inflammation, fibrosis, and cardiac dysfunction. Strategies inducing v-ATPase reassembly, that is, to achieve CD36 reinternalization, may correct these maladaptive alterations. For this, we used NAD+ (nicotinamide adenine dinucleotide)-precursor nicotinamide mononucleotide (NMN), inducing v-ATPase reassembly by stimulating glycolytic enzymes to bind to v-ATPase. METHODS: Rats/mice on cardiomyopathy-inducing high-fat diets were supplemented with NMN and for comparison with a cocktail of lysine/leucine/arginine (mTORC1 [mechanistic target of rapamycin complex 1]-mediated v-ATPase reassembly). We used the following methods: RNA sequencing, mRNA/protein expression analysis, immunofluorescence microscopy, (co)immunoprecipitation/proximity ligation assay (v-ATPase assembly), myocellular uptake of [3H]chloroquine (endosomal pH), and [14C]palmitate, targeted lipidomics, and echocardiography. To confirm the involvement of v-ATPase in the beneficial effects of both supplementations, mTORC1/v-ATPase inhibitors (rapamycin/bafilomycin A1) were administered. Additionally, 2 heart-specific v-ATPase-knockout mouse models (subunits V1G1/V0d2) were subjected to these measurements. Mechanisms were confirmed in pharmacologically/genetically manipulated cardiomyocyte models of lipid overload. RESULTS: NMN successfully preserved endosomal acidification during myocardial lipid overload by maintaining v-ATPase activity and subsequently prevented CD36-mediated lipid accumulation, CD36-TLR4 interaction toward inflammation, fibrosis, cardiac dysfunction, and whole-body insulin resistance. Lipidomics revealed C18:1-enriched diacylglycerols as lipid class prominently increased by high-fat diet and subsequently reversed/preserved by lysine/leucine/arginine/NMN treatment. Studies with mTORC1/v-ATPase inhibitors and heart-specific v-ATPase-knockout mice further confirmed the pivotal roles of v-ATPase in these beneficial actions. CONCLUSION: NMN preserves heart function during lipid overload by preventing v-ATPase disassembly.

CD36 inhibition reduces non-small-cell lung cancer development through AKT-mTOR pathway.

Lung cancer is the most common cause of cancer-related deaths worldwide and is caused by multiple factors, including high-fat diet (HFD). CD36, a fatty acid receptor, is closely associated with metabolism-related diseases, including cardiovascular disease and cancer. However, the role of CD36 in HFD-accelerated non-small-cell lung cancer (NSCLC) is unclear. In vivo, we fed C57BL/6J wild-type (WT) and CD36 knockout (CD36-/-) mice normal chow or HFD in the presence or absence of pitavastatin 2 weeks before subcutaneous injection of LLC1 cells. In vitro, A549 and NCI-H520 cells were treated with free fatty acids (FFAs) to mimic HFD situation for exploration the underlying mechanisms. We found that HFD promoted LLC1 tumor growth in vivo and that FFAs increased cell proliferation and migration in A549 and NCI-H520 cells. The enhanced cell or tumor growth was inhibited by the lipid-lowering agent pitavastatin, which reduced lipid accumulation. More importantly, we found that plasma soluble CD36 (sCD36) levels were higher in NSCLC patients than those in healthy ones. Compared to that in WT mice, the proliferation of LLC1 cells in CD36-/- mice was largely suppressed, which was further repressed by pitavastatin in HFD group. At the molecular level, we found that CD36 inhibition, either with pitavastatin or plasmid, reduced proliferation- and migration-related protein expression through the AKT/mTOR pathway. Taken together, we demonstrate that inhibition of CD36 expression by pitavastatin or other inhibitors may be a viable strategy for NSCLC treatment.

Cellular localization and potential ligands of a novel scavenger receptor class B/CD36 protein homolog (Pt-SRB2) identified in the marine crab, Portunustrituberculatus.

The scavenger receptor class B family proteins (SRB) are multiligand membrane receptor proteins. Herein, a novel SRB homolog (Pt-SRB2) was identified in Portunus trituberculatus. The open reading frame of Pt-SRB2 was predicted to encode 520 amino acid residues comprising a typical CD36 domain. Phylogenetic analysis showed that Pt-SRB2 distinctly clustered with the SRB homologs of most crustaceans and Drosophila but was separate from all vertebrate CD36/SRB. Semi-quantitative and Real-time quantitative PCR revealed that the abundance of Pt-SRB2 transcripts was the highest in hepatopancreas than in other tested tissues. Overexpressed Pt-SRB2 was distributed primarily in the cell membrane and cytoplasm of HEK293T or Drosophila Schneider 2 cells. In crab hemocytes, Pt-SRB2 was distributed primarily in the cell membrane by immunofluorescence staining. In addition, the immunofluorescence staining showed that green fluorescence signals were mainly located in the inner lumen membrane of the hepatopancreatic tubules. Moreover, solid-phase enzyme-linked immunosorbent assay revealed that rPt-SRB2-L exhibited relative high affinity with lipopolysaccharides, and relative moderate binding affinity with lipoteichoic acid or peptidoglycan. Of note, rPt-SRB2-L showed high binding affinity with eicosapentaenoic acid among a series of long-chain polyunsaturated fatty acids. Taken together, this study provided valuable data for understanding the functions of the crab CD36/SRB.

CD36: The Bridge between Lipids and Tumors.

It has been found that the development of some cancers can be attributed to obesity, which is associated with the excessive intake of lipids. Cancer cells undergo metabolic reprogramming, shifting from utilizing glucose to fatty acids (FAs) for energy. CD36, a lipid transporter, is highly expressed in certain kinds of cancer cells. High expressions of CD36 in tumor cells triggers FA uptake and lipid accumulation, promoting rapid tumor growth and initiating metastasis. Meanwhile, immune cells in the tumor microenvironment overexpress CD36 and undergo metabolic reprogramming. CD36-mediated FA uptake leads to lipid accumulation and has immunosuppressive effects. This paper reviews the types of FAs associated with cancer, high expressions of CD36 that promote cancer development and progression, effects of CD36 on different immune cells in the tumor microenvironment, and the current status of CD36 as a therapeutic target for the treatment of tumors with high CD36 expression.

BDE-47 induces metabolic dysfunction-associated steatotic liver disease (MASLD) through CD36-mediated increased fatty acid uptake and PPARα-induced abnormal fatty acid oxidation in BALB/c mice.

The widespread existence of 2,2',4,4'-tetra-bromodiphenyl ether (BDE-47) in the environment has aroused great concern. BDE-47 induces the occurrence of metabolic dysfunction-associated steatotic liver disease (MASLD), but the mechanism has not been fully elucidated. Here, we further investigate the underlying mechanism using BALB/c mice. After BDE-47 exposure, the livers of mice enlarged, the serum levels of ALT, ALP, TG and TC enhanced, and hepatic steatosis occurred. Transcriptome sequencing identifies 2250 differentially expressed genes (DEGs). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis reveals that down-regulated DEGs are mainly enriched in pathways associated with lipid metabolism, particularly in fatty acid (FA) degradation. And up-regulated DEGs are mainly enriched in pathways related to lipid and FA transport. The expression levels of AhR, Pparγ and Cd36 involved in FA uptake are up-regulated, and those of PPARα and target genes including Cpt1 and Cyp4a1 related to ß and ω-oxidation are inhibited. These results reveal BDE-47 could lead to metabolic dysfunction-associated steatotic liver disease (MASLD) by promoting FA uptake via upregulating Cd36 and hindering oxidative utilization by downregulating PPARα.

Fatty acid translocase (FAT/CD36) in silver pomfret (Pampus argenteus): Molecular cloning and functional characterization.

Understanding the mechanisms of lipid transport and metabolism in fish is crucial to enhance dietary lipid utilization. Here, fatty acid translocase (CD36) gene was characterized in silver pomfret (Pampus argenteus). The open reading frame of silver pomfret cd36 gene was 1395 bp, encoding 464 amino acids. The silver pomfret CD36 protein contained typical transmembrane regions and N-glycosylation modification sites, and was localized to the cytomembrane. The cd36 gene was ubiquitously expressed in all tested tissues, with the highest expression observed in brain tissue. In vivo, both fasting and short-term high-fat feeding could increase cd36 expression in intestinal tissue. In vitro, cd36 expression was induced by palmitic acid, oleic acid, linolenic acid, eicosapentaenoic acid (EPA), and docosahexaenoic acid treatment in intestinal tissue. Furthermore, dual-luciferase reporter assay results indicated that peroxisome proliferator-activated receptor gamma (PPARγ) could enhance cd36 promoter activity, and the co-expression of cd36 and pparγ was observed in EPA-incubated intestine, suggesting that EPA may regulate the expression of cd36 via PPARγ to maintain the homeostasis of intestinal lipid metabolism in silver pomfret. These results highlighted the crucial role of CD36 in silver pomfret, and suggested that the cd36 expression may be regulated by PPARγ. This study could contribute to a greater understanding of lipid metabolism and the development of effective strategies for nutrient requirements in fish.

Cholesterol deficiency as a mechanism for autism: A valproic acid model.

Dysregulated cholesterol metabolism represents an increasingly recognized feature of autism spectrum disorder (ASD). Children with fetal valproate syndrome caused by prenatal exposure to valproic acid (VPA), an anti-epileptic and mood-stabilizing drug, have a higher incidence of developing ASD. However, the role of VPA in cholesterol homeostasis in neurons and microglial cells remains unclear. Therefore, we examined the effect of VPA exposure on regulation of cholesterol homeostasis in the human microglial clone 3 (HMC3) cell line and the human neuroblastoma cell line SH-SY5Y. HMC3 and SH-SY5Y cells were each incubated in increasing concentrations of VPA, followed by quantification of mRNA and protein expression of cholesterol transporters and cholesterol metabolizing enzymes. Cholesterol efflux was evaluated using colorimetric assays. We found that VPA treatment in HMC3 cells significantly reduced ABCA1 mRNA, but increased ABCG1 and CD36 mRNA levels in a dose-dependent manner. However, ABCA1 and ABCG1 protein levels were reduced by VPA in HMC3. Furthermore, similar experiments in SH-SY5Y cells showed increased mRNA levels for ABCA1, ABCG1, CD36, and 27-hydroxylase with VPA treatment. VPA exposure significantly reduced protein levels of ABCA1 in a dose-dependent manner, but increased the ABCG1 protein level at the highest dose in SH-SY5Y cells. In addition, VPA treatment significantly increased cholesterol efflux in SH-SY5Y, but had no impact on efflux in HMC3. VPA differentially controls the expression of ABCA1 and ABCG1, but regulation at the transcriptional and translational levels are not consistent and changes in the expression of these genes do not correlate with cholesterol efflux in vitro.

CD36 deletion ameliorates diabetic kidney disease by restoring fatty acid oxidation and improving mitochondrial function.

Renal tubular epithelial cells (TECs) are vulnerable to mitochondrial dysregulation, which is an integral part of diabetic kidney disease (DKD). We found that CD36 knockout ameliorated mitochondrial dysfunction and diabetic kidney injury in mice, improved renal function, glomerular hypertrophy, tubular injury, tubulointerstitial fibrosis, and kidney cell apoptosis. Furthermore, CD36 knockout conferred protection against diabetes-induced mitochondrial dysfunction and restored renal tubular cells and mitochondrial morphology. CD36 knockout also restored mitochondrial fatty acid oxidation (FAO) and enhanced FAO-associated respiration in diabetic TECs. CD36 was found to alter cellular metabolic pathways in diabetic kidneys partly via PDK4 the -AMPK axis inactivation. Because CD36 protects against DKD by improving mitochondrial function and restoring FAO, it can serve as a potential therapeutic target.

Variantes genéticas en CD36: evidencia emergente en la percepción oral de las grasas y las preferencias alimentarias / Genetic variants in CD36: emerging role in oral fat perception and food preferences

CD36 es un receptor involucrado en procesos fisiológicos, metabólicos y patológicos. Debido a su afinidad por ácidos grasos de cadena larga es uno de los principales receptores de lípidos provenientes de la dieta. En esta revisión se analiza la evidencia genética emergente que vincula a CD36 en la percepción oral de grasa. Se realizó una búsqueda sistemática en la base de datos PubMed considerando artículos publicados en el periodo 2000-2022. Múltiples estudios asocian a algunas variantes genéticas en CD36 con las preferencias por alimentos con contenido graso y se ha postulado que estas variantes pueden modificar los umbrales de percepción oral de grasas, sin embargo, la evidencia es heterogénea; esto puede ser explicado por la diversidad genética de las poblaciones, el estado nutricional y características de los participantes, así como a otros aspectos metodológicos. Se identificaron y se discuten otros factores implicados en la percepción oral de grasas, incluyendo la interacción con otros sabores, hormonas y factores epigenéticos. Se concluye que la evidencia que apoya el papel de CD36 como receptor de los lípidos provenientes de la dieta es intermedio y son necesarias más investigaciones en diversas poblaciones con un gran número de participantes, así como considerar la interacción entre distintas hormonas y la expresión de CD36. (AU)

CD36 is a receptor involved in physiologic, metabolic and pathologic processes. Due to its affinity for long-chain fatty acids, it has been postulated as a taste receptor of fatty taste. In this review, the emerging genetic evidence linking CD36 to oral fat perception is analyzed. A systematic literature search was conducted in PubMed, published articles from 2000 to 2022 were considered. Multiple studies have shown an association of some genetic variants in CD36 with fat foods preferences and it has been suggested that these variants can modify oral fat perception thresholds however the evidence is still heterogeneous; this can be explained by the genetic diversity of populations, the nutritional status and participant’s characteristics, as well as other methodological aspects. Other factors involved in oral fat perception were and identified and discussed including the interaction with other flavors, hormones, and epigenetic factors. The conclusion is that the evidence supporting the role of CD36 as a dietary lipid receptor, the role of its genetic variants in fat acids oral perception thresholds and food preferences is intermediate level and more research is necessary in other populations with large number of participants as well as considering the interaction between different hormones and the expression of CD36. (AU)

Genetic Variants in CD36 Involved in Fat Taste Perception: Association with Anthropometric and Clinical Parameters in Overweight and Obese Subjects Affected by Type 2 Diabetes or Dysglycemia-A Pilot Study.

Obesity and overweight represent a growing health problem worldwide. Genes regulating the intake and metabolism of different nutrients can positively or negatively influence the efficacy of nutritional interventions against obesity and its complications. The aim of this study was to assess changes in anthropometric and clinical parameters and the adherence to a Mediterranean diet (MedDiet) over time in relation to nutrigenetic variants in overweight or obese subjects affected by Type 2 Diabetes (T2D) or dysglycemia, who were included in a nutritional program. A total of 23 subjects were included in this study. Clinical parameters, physical activity levels, and the adherence to a MedDiet were evaluated at baseline, at 6 (T6), and at 12 months (T12) during and after a diet/lifestyle intervention. In a single blood sample from each subject, rs1984112 (A>G) and rs1761667 (G>A) in CD36; rs7950226 (G>A) in BMAL1; and rs1801260 (A>G), rs4864548 (A>G), and rs3736544 (G>A) in CLOCK were genotyped with Real-Time PCR. Significant associations were observed between CD36 rs1761667 and weight (p = 0.025), hip circumference (p = 0.042), triglycerides (p = 0.047), and HbA1c (p = 0.012) at baseline. Moreover, the genotype AA in CD36 rs1761667 was significantly associated with a lower BMI when compared to G carriers at baseline, at T6, and also at T12. In addition, subjects with the AA genotype at CD36 rs1984112 had significantly lower levels of HbA1c (p = 0.027) than the GG and AG genotypes at baseline. These results show that variants in CD36 can have an impact on anthropometric and clinical parameters in overweight or obese subjects affected by T2D or dysglycemia, and that it might influence the success of the diet/lifestyle intervention.

Phylogenetic and Protein Structure Analyses Provide Insight into the Evolution and Diversification of the CD36 Domain "Apex" among Scavenger Receptor Class B Proteins across Eukarya.

The cluster of differentiation 36 (CD36) domain defines the characteristic ectodomain associated with class B scavenger receptor (SR-B) proteins. In bilaterians, SR-Bs play critical roles in diverse biological processes including innate immunity functions such as pathogen recognition and apoptotic cell clearance, as well as metabolic sensing associated with fatty acid uptake and cholesterol transport. Although previous studies suggest this protein family is ancient, SR-B diversity across Eukarya has not been robustly characterized. We analyzed SR-B homologs identified from the genomes and transcriptomes of 165 diverse eukaryotic species. The presence of highly conserved amino acid motifs across major eukaryotic supergroups supports the presence of a SR-B homolog in the last eukaryotic common ancestor. Our comparative analyses of SR-B protein structure identify the retention of a canonical asymmetric beta barrel tertiary structure within the CD36 ectodomain across Eukarya. We also identify multiple instances of independent lineage-specific sequence expansions in the apex region of the CD36 ectodomain-a region functionally associated with ligand-sensing. We hypothesize that a combination of both sequence expansion and structural variation in the CD36 apex region may reflect the evolution of SR-B ligand-sensing specificity between diverse eukaryotic clades.

CD36 Protects Tumor Cells from Lipotoxicity During Metastasis.

CD36 supports metastasis by regulating lipid homeostasis during matrix detachment in breast cancer.

[Genetic variants in CD36: emerging role in oral fat perception and food preferences]. / Variantes genéticas en CD36: evidencia emergente en la percepción oral de las grasas y las preferencias alimentarias.

Introduction: CD36 is a receptor involved in physiologic, metabolic and pathologic processes. Due to its affinity for long-chain fatty acids, it has been postulated as a taste receptor of fatty taste. In this review, the emerging genetic evidence linking CD36 to oral fat perception is analyzed. A systematic literature search was conducted in PubMed, published articles from 2000 to 2022 were considered. Multiple studies have shown an association of some genetic variants in CD36 with fat foods preferences and it has been suggested that these variants can modify oral fat perception thresholds however the evidence is still heterogeneous; this can be explained by the genetic diversity of populations, the nutritional status and participant's characteristics, as well as other methodological aspects. Other factors involved in oral fat perception were and identified and discussed including the interaction with other flavors, hormones, and epigenetic factors. The conclusion is that the evidence supporting the role of CD36 as a dietary lipid receptor, the role of its genetic variants in fat acids oral perception thresholds and food preferences is intermediate level and more investigations are necessary in other populations with large number of participants as well as considering the interaction between different hormones and the expression of CD36.

Introducción: CD36 es un receptor involucrado en procesos fisiológicos, metabólicos y patológicos. Debido a su afinidad por ácidos grasos de cadena larga es uno de los principales receptores de lípidos provenientes de la dieta. En esta revisión se analiza la evidencia genética emergente que vincula a CD36 en la percepción oral de grasa. Se realizó una búsqueda sistemática en la base de datos PubMed considerando artículos publicados en el periodo 2000-2022. Múltiples estudios asocian a algunas variantes genéticas en CD36 con las preferencias por alimentos con contenido graso y se ha postulado que estas variantes pueden modificar los umbrales de percepción oral de grasas, sin embargo, la evidencia es heterogénea; esto puede ser explicado por la diversidad genética de las poblaciones, el estado nutricional y características de los participantes, así como a otros aspectos metodológicos. Se identificaron y se discuten otros factores implicados en la percepción oral de grasas, incluyendo la interacción con otros sabores, hormonas y factores epigenéticos. Se concluye que la evidencia que apoya el papel de CD36 como receptor de los lípidos provenientes de la dieta es intermedio y son necesarias más investigaciones en diversas poblaciones con un gran número de participantes, así como considerar la interacción entre distintas hormonas y la expresión de CD36.